Stem-loop sequence rco-MIR166d

AccessionMI0013389 (change log)
DescriptionRicinus communis miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention rco-MIR166d
(5 sentences)

Stem-loop
   --  a        cu             c     ----   -     c 
5'   ug ggggaaug  gucugguucgaga cauuc    gcu ugaug c
     || ||||||||  ||||||||||||| |||||    ||| ||||| a
3'   ac ccccuuac  cggaccaggcucu guaag    cga acuac c
   ca  c        uu             a     ucuu   c     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973814.1: 45140-45231 [+]
intergenic
Database links

Mature sequence rco-miR166d

Accession MIMAT0014163
Sequence

67 - 

ucggaccaggcuucauucccc

 - 87

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).