Stem-loop sequence rco-MIR166e

AccessionMI0013390 (change log)
DescriptionRicinus communis miR166e stem-loop
Gene family MIPF0000004; MIR166
Literature search

2 open access papers mention rco-MIR166e
(5 sentences)

Stem-loop
   --  a        uu      cu   g   u  c  --u     --   uucaauuuu    auag    a 
5'   ug ggggaaug  gucugg  cga gac cu uu   ugauc  ccu         cucc    aucc a
     || ||||||||  ||||||  ||| ||| || ||   |||||  |||         ||||    |||| u
3'   ac ccccuuac  cggacc  gcu cug ga ag   acuag  ggg         gagg    uagg a
   ua  c        uu      ag   g   u  c  uuu     au   --------u    guua    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974167.1: 24073-24203 [+]
intergenic
Database links

Mature sequence rco-miR166e

Accession MIMAT0014164
Sequence

106 - 

ucggaccaggcuucauucccc

 - 126

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).