Stem-loop sequence rco-MIR167b

AccessionMI0013392 (change log)
DescriptionRicinus communis miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention rco-MIR167b
(16 sentences)

Stem-loop
   --ucagu           g        aa    -     cc 
5'        ugaagcugcca caugaucu  aucu uccuc  u
          ||||||||||| ||||||||  |||| |||||  c
3'        acuuugacggu guacuaga  uaga aggag  g
   guugccc           -        -c    g     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973814.1: 390753-390832 [-]
intergenic
Database links

Mature sequence rco-miR167b

Accession MIMAT0014166
Sequence

6 - 

ugaagcugccagcaugaucua

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).