Stem-loop sequence rco-MIR167c

AccessionMI0013393 (change log)
DescriptionRicinus communis miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

2 open access papers mention rco-MIR167c
(18 sentences)

Stem-loop
   --    u           g          ag       a 
5'   auag ugaagcugcca caugaucugg  cuuuucu u
     |||| ||||||||||| ||||||||||  |||||||  
3'   uguc acuuugacggu guacuagauc  gagagga c
   gu    c           -          -a       c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973777.1: 23860-23935 [-]
intergenic
Database links

Mature sequence rco-miR167c

Accession MIMAT0014167
Sequence

6 - 

ugaagcugccagcaugaucugg

 - 27

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).