Stem-loop sequence rco-MIR168

AccessionMI0013394 (change log)
DescriptionRicinus communis miR168 stem-loop
Gene family MIPF0000081; MIR168
Literature search

2 open access papers mention rco-MIR168
(5 sentences)

Stem-loop
   --cua     c          u     a ug   g       uauu      gauuu    gc   g 
5'      auucg uuggugcagg cggga c  auu gcuuuuc    ucuaau     ccag  ggc a
        ||||| |||||||||| ||||| |  ||| |||||||    ||||||     ||||  ||| a
3'      uaagu aacuacguuc gcccu g  uaa ugaaagg    agauua     gguu  uug a
   gaagc     c          c     a gu   g       ---u      gaacu    -a   a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973781.1: 686511-686641 [+]
intergenic
Database links

Mature sequence rco-miR168

Accession MIMAT0014168
Sequence

6 - 

ucgcuuggugcaggucgggaa

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).