Stem-loop sequence rco-MIR169a

AccessionMI0013395 (change log)
DescriptionRicinus communis miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

2 open access papers mention rco-MIR169a
(6 sentences)

Stem-loop
   --     c          ga        cauc   u          u 
5'   gaaua agccaaggau  cuugccgg    aau uauauauaua a
     ||||| ||||||||||  ||||||||    ||| ||||||||||  
3'   cuuau ucgguucuug  gaacggcu    uua auauauauau u
   ua     a          uc        --au   u          a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973825.1: 235763-235854 [-]
intergenic
Database links

Mature sequence rco-miR169a

Accession MIMAT0014169
Sequence

6 - 

cagccaaggaugacuugccgg

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).