Stem-loop sequence rco-MIR169b

AccessionMI0013396 (change log)
DescriptionRicinus communis miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

2 open access papers mention rco-MIR169b
(6 sentences)

Stem-loop
   --uaauuc         ug         cac   cuauaua   cuu 
5'         agccaagga  acuugccgg   agc       ugu   c
           |||||||||  |||||||||   |||       |||   u
3'         ucgguucuu  ugaacggcc   ucg       aca   a
   auguuaca         gu         --a   aucgucg   cuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974072.1: 117879-117971 [-]
intergenic
Database links

Mature sequence rco-miR169b

Accession MIMAT0014170
Sequence

6 - 

cagccaaggaugacuugccgg

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).