Stem-loop sequence rco-MIR169c

AccessionMI0013397 (change log)
DescriptionRicinus communis miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

2 open access papers mention rco-MIR169c
(6 sentences)

Stem-loop
   --   ccu            a         cauauauaaaauucuuucugucgccag 
5'   gga   gagccaaggaug cuugccgcg                           c
     |||   |||||||||||| |||||||||                            
3'   cuu   cucgguucuuac gaacggugc                           a
   ca   cau            a         cuuuugggaaaaguccgauagcuacua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973994.1: 125654-125767 [-]
intergenic
Database links

Mature sequence rco-miR169c

Accession MIMAT0014171
Sequence

6 - 

ugagccaaggaugacuugccg

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).