Stem-loop sequence rco-MIR171a

AccessionMI0013398 (change log)
DescriptionRicinus communis miR171a stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention rco-MIR171a
(8 sentences)

Stem-loop
   --aa   g        uc         a     a   u     aaa 
5'     acg gauauugg  cgguucaau agaaa cag gcuca   u
       ||| ||||||||  ||||||||| ||||| ||| |||||    
3'     ugc cuauaacc  gccgaguua uuuuu guc cgggu   g
   cacg   a        gu         g     c   c     auu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973932.1: 488002-488093 [-]
intergenic
Database links

Mature sequence rco-miR171a

Accession MIMAT0014172
Sequence

67 - 

uugagccgugccaauaucacg

 - 87

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).