Stem-loop sequence rco-MIR171b

AccessionMI0013399 (change log)
DescriptionRicinus communis miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention rco-MIR171b
(8 sentences)

Stem-loop
   --     a        ug             g u  -uu      u 
5'   guacg gauauugg  cgguucaaucaga a ca   gcucua a
     ||||| ||||||||  ||||||||||||| | ||   ||||||  
3'   cgugc cuauaacc  gccgaguuaguuu u gu   cgagau u
   ua     a        gu             g u  uuu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973828.1: 404395-404485 [+]
intergenic
Database links

Mature sequence rco-miR171b

Accession MIMAT0014173
Sequence

66 - 

uugagccgugccaauaucacg

 - 86

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).