Stem-loop sequence rco-MIR171c

AccessionMI0013400 (change log)
DescriptionRicinus communis miR171c stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention rco-MIR171c
(8 sentences)

Stem-loop
   --ucu                     a  cg   c       u 
5'      gauguuggcaugguucaauca au  aag acucagc g
        ||||||||||||||||||||| ||  ||| ||||||| c
3'      cuauaaccgugccgaguuagu ua  uuc ugagucg c
   uaccg                     c  au   u       u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973774.1: 627331-627417 [-]
intergenic
Database links

Mature sequence rco-miR171c

Accession MIMAT0014174
Sequence

62 - 

ugauugagccgugccaauauc

 - 82

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).