Stem-loop sequence rco-MIR171d

AccessionMI0013401 (change log)
DescriptionRicinus communis miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention rco-MIR171d
(8 sentences)

Stem-loop
   --ugu         c       c     caaaaacgauguguuuucucaagcauuuguuuuu 
5'      gauguuggc cgguuca ucaga                                  c
        ||||||||| ||||||| |||||                                   
3'      cuauaaccg gccgagu aguuu                                  g
   ugauu         u       u     ccgguaauacgaacacaauuguauaguucgcaaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973772.1: 3804732-3804855 [-]
intergenic
Database links

Mature sequence rco-miR171d

Accession MIMAT0014175
Sequence

99 - 

ugauugagccgugccaauauc

 - 119

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).