Stem-loop sequence rco-MIR171e

AccessionMI0013402 (change log)
DescriptionRicinus communis miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention rco-MIR171e
(9 sentences)

Stem-loop
   --           a            a  c   ucu     a 
5'   ggggauguugg auggcucaauca au aaa   cccaa g
     ||||||||||| |||||||||||| || |||   |||||  
3'   ccccuauaacc ugccgaguuagu ua uuu   ggguu u
   ac           g            c  a   ccu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973773.1: 2233794-2233877 [-]
intergenic
Database links

Mature sequence rco-miR171e

Accession MIMAT0014176
Sequence

59 - 

ugauugagccgugccaauauc

 - 79

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).