Stem-loop sequence rco-MIR171f

AccessionMI0013403 (change log)
DescriptionRicinus communis miR171f stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention rco-MIR171f
(8 sentences)

Stem-loop
   --  u         c       c     -    ---a   cuau    uc  cu  u 
5'   ug gauauuggc ugguuca ucaga caug    aac    cccu  uc  gc u
     || ||||||||| ||||||| ||||| ||||    |||    ||||  ||  || a
3'   ac cuauaaccg gccgagu aguuu guau    uug    ggga  ag  cg u
   ug  u         u       u     u    aucg   uugu    ua  uc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974221.1: 175562-175672 [+]
intergenic
Database links

Mature sequence rco-miR171f

Accession MIMAT0014177
Sequence

86 - 

ugauugagccgugccaauauc

 - 106

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).