Stem-loop sequence rco-MIR171g

AccessionMI0013404 (change log)
DescriptionRicinus communis miR171g stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

3 open access papers mention rco-MIR171g
(8 sentences)

Stem-loop
   --  c          a         c  a  -  -ga      cau 
5'   ag gauguuggug gguucaauc ga ga cg   uuuaca   u
     || |||||||||| ||||||||| || || ||   ||||||    
3'   uc cuauaaccgc ccgaguuag cu cu gc   aaaugu   c
   uu  a          g         a  -  a  agg      ugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974034.1: 63328-63416 [-]
intergenic
Database links

Mature sequence rco-miR171g

Accession MIMAT0014178
Sequence

64 - 

agauugagccgcgccaauauc

 - 84

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).