Stem-loop sequence rco-MIR172

AccessionMI0013405 (change log)
DescriptionRicinus communis miR172 stem-loop
Gene family MIPF0000035; MIR172
Literature search

3 open access papers mention rco-MIR172
(11 sentences)

Stem-loop
   --   a  g                a  aacuu    -u    -   g       uu ug ucccuuuucuuuuu 
5'   cug ug agcaucaucaagauuc ca     uauc  aggg cua uggguug  g  g              c
     ||| || |||||||||||||||| ||     ||||  |||| ||| |||||||  |  |              u
3'   ggc ac ucguaguaguucuaag gu     auag  uccc gau accuaac  c  u              u
   ac   g  g                g  -----    uu    u   a       uu gu cucuuuuucuuuuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974292.1: 52781-52924 [+]
intergenic
Database links

Mature sequence rco-miR172

Accession MIMAT0014179
Sequence

119 - 

ggaaucuugaugaugcugcag

 - 139

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).