Stem-loop sequence rco-MIR319a

AccessionMI0013406 (change log)
DescriptionRicinus communis miR319a stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention rco-MIR319a
(5 sentences)

Stem-loop
   --uu   a     uu          cuc     u   gg            a -  g   ac       uc  aauacugaguuaaaaaguucagaaaacaaaagg 
5'     aag gagcu  cuucagucca   auggg ggc  uaggauuuaauu g cu ccg  ucauuca  ca                                 g
       ||| |||||  ||||||||||   ||||| |||  |||||||||||| | || |||  |||||||  ||                                 g
3'     uuc cucga  gaagucaggu   ugucc ucg  auucuaaguuaa c ga ggc  aguaagu  gu                                 c
   ucau   c     gg          uca     u   -a            a a  g   gu       ga  aaaugacccauuuggaagaaaagaugucguggg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973774.1: 3280054-3280264 [-]
intergenic
Database links

Mature sequence rco-miR319a

Accession MIMAT0014180
Sequence

186 - 

uuggacugaagggagcucccu

 - 206

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).