Stem-loop sequence rco-MIR319b

AccessionMI0013407 (change log)
DescriptionRicinus communis miR319b stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention rco-MIR319b
(4 sentences)

Stem-loop
   --aa  a                   uc  a       gag       acu     g u ac       u       cu    a  aucaa 
5'     ga ggagcucucuucaguccag  ca ggcgguu   ggcuggg   uagcu c g  ucguugg ucaagag  cauc uc     u
       || |||||||||||||||||||  || |||||||   |||||||   ||||| | |  ||||||| |||||||  |||| ||      
3'     cu ccucgagggaagucagguu  gu cugucgg   uugacuu   gucga g c  agcaacc aguuuuu  guag ag     g
   uaac  c                   cu  a       -ua       -gu     g u ga       u       cu    -  aaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974005.1: 22062-22240 [+]
intergenic
Database links

Mature sequence rco-miR319b

Accession MIMAT0014181
Sequence

154 - 

uuggacugaagggagcucccu

 - 174

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).