Stem-loop sequence rco-MIR319c

AccessionMI0013408 (change log)
DescriptionRicinus communis miR319c stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention rco-MIR319c
(4 sentences)

Stem-loop
   --uu   a                 cu      cg  c    guuu    --      g   ac        u  aa    c   aaa  ggag au 
5'     aag gagcucucuucagucca  cauggg  gg gaag    ugaa  uuaucu ccg  ucauucau ca  caca uag   ag    c  u
       ||| |||||||||||||||||  ||||||  || ||||    ||||  |||||| |||  |||||||| ||  |||| |||   ||    |   
3'     uuc cucgagggaagucaggu  gugucu  uc cuuc    acuu  aauaga ggc  aguaagug gu  gugu auc   uc    g  a
   cgau   c                 uc      cu  u    --au    ua      g   gu        u  aa    u   --g  gaua aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974605.1: 5923-6110 [-]
intergenic
Database links

Mature sequence rco-miR319c

Accession MIMAT0014182
Sequence

163 - 

uuggacugaagggagcucccu

 - 183

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).