Stem-loop sequence rco-MIR319d

AccessionMI0013409 (change log)
DescriptionRicinus communis miR319d stem-loop
Gene family MIPF0000010; MIR159
Literature search

2 open access papers mention rco-MIR319d
(4 sentences)

Stem-loop
   --cca                      --a   a   cuu  a  c  c  a  ---   g    cu         a   aau      caagu     a 
5'      aaggagcuccuuucaguccaau   ugg ggg   ag ag gg aa ga   gcu ccau  caugcauua ggc   acuuga     uuuuc c
        ||||||||||||||||||||||   ||| |||   || || || || ||   ||| ||||  ||||||||| |||   ||||||     ||||| a
3'      uuccucgagggaagucagguua   acc ccc   uc uc cc uu cu   cga ggug  guacguggu ccg   ugaacu     aaaag g
   cuuuc                      ccc   -   --u  c  -  -  c  caa   g    ug         -   guu      ---cu     u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974515.1: 60971-61157 [+]
intergenic
Database links

Mature sequence rco-miR319d

Accession MIMAT0014183
Sequence

162 - 

uuggacugaagggagcuccuu

 - 182

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).