Stem-loop sequence rco-MIR390b

AccessionMI0013411 (change log)
DescriptionRicinus communis miR390b stem-loop
Gene family MIPF0000101; MIR390
Literature search

1 open access papers mention rco-MIR390b
(25 sentences)

Stem-loop
   -     -          g         c     -u     uguguuuuuaugaauaugacu 
5'  cuaau aagcucagga ggauagcgc augga  ggaua                     c
    ||||| |||||||||| ||||||||| |||||  |||||                     g
3'  gguua uuugaguccu ccuaucgcg uaucu  ucuau                     u
   u     c          a         a     uc     uuuuuucguucgguucuuuuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974008.1: 153671-153792 [+]
intergenic
Database links

Mature sequence rco-miR390b

Accession MIMAT0014185
Sequence

6 - 

aagcucaggagggauagcgcc

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).