Stem-loop sequence rco-MIR393

AccessionMI0013412 (change log)
DescriptionRicinus communis miR393 stem-loop
Gene family MIPF0000083; MIR393
Literature search

2 open access papers mention rco-MIR393
(11 sentences)

Stem-loop
   --aaag    a            u         uc       ---accuaa    g 
5'       uucc aagggaucgcau gaucuaaug  guugggu         auga u
         |||| |||||||||||| |||||||||  |||||||         |||| u
3'       aagg uucccuagcgua cuagguuac  uaaccua         uauu a
   ccucug    a            -         -u       auaucuaaa    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973773.1: 26964-27071 [+]
intergenic
Database links

Mature sequence rco-miR393

Accession MIMAT0014186
Sequence

6 - 

uccaaagggaucgcauugauc

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).