Stem-loop sequence rco-MIR395a

AccessionMI0013413 (change log)
DescriptionRicinus communis miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

2 open access papers mention rco-MIR395a
(7 sentences)

Stem-loop
   -- u          ug         cug   c   aa 
5'   c agaguucccu  aacacuuca   gga gaa  u
     | ||||||||||  |||||||||   ||| |||   
3'   g ucucaagggg  uugugaagu   ccu cuu  c
   ug u          gu         caa   u   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973849.1: 133932-134005 [-]
intergenic
Clustered miRNAs
< 10kb from rco-MIR395a
rco-MIR395cEQ973849.1: 142167-142248 [+]
rco-MIR395dEQ973849.1: 136644-136730 [-]
rco-MIR395aEQ973849.1: 133932-134005 [-]
Database links

Mature sequence rco-miR395a

Accession MIMAT0014187
Sequence

49 - 

cugaaguguuugggggaacuc

 - 69

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).