Stem-loop sequence rco-MIR395b

AccessionMI0013414 (change log)
DescriptionRicinus communis miR395b stem-loop
Gene family MIPF0000016; MIR395
Literature search

2 open access papers mention rco-MIR395b
(7 sentences)

Stem-loop
   --            ug c       u      -uauuau    ccuuaa 
5'   cuggaguucccc  g cgcuuca uggggc       auac      u
     ||||||||||||  | ||||||| ||||||       ||||       
3'   gaucucaagggg  u gugaagu aucccg       ugug      u
   ug            gu u       c      uccuuau    uacaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973849.1: 150771-150867 [+]
intergenic
Clustered miRNAs
< 10kb from rco-MIR395b
rco-MIR395cEQ973849.1: 142167-142248 [+]
rco-MIR395bEQ973849.1: 150771-150867 [+]
Database links

Mature sequence rco-miR395b

Accession MIMAT0014188
Sequence

72 - 

cugaaguguuugggggaacuc

 - 92

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).