Stem-loop sequence rco-MIR395c

AccessionMI0013415 (change log)
DescriptionRicinus communis miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

2 open access papers mention rco-MIR395c
(7 sentences)

Stem-loop
   -    -        ug         c     -u   aaaag 
5'  cuag aguucccu  agcacuuca uggga  gaa     g
    |||| ||||||||  ||||||||| |||||  |||     u
3'  gguc ucaagggg  uugugaagu auccu  cuu     c
   u    c        gu         c     uc   cugac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973849.1: 142167-142248 [+]
intergenic
Clustered miRNAs
< 10kb from rco-MIR395c
rco-MIR395aEQ973849.1: 133932-134005 [-]
rco-MIR395dEQ973849.1: 136644-136730 [-]
rco-MIR395cEQ973849.1: 142167-142248 [+]
rco-MIR395bEQ973849.1: 150771-150867 [+]
Database links

Mature sequence rco-miR395c

Accession MIMAT0014189
Sequence

57 - 

cugaaguguuugggggaacuc

 - 77

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).