Stem-loop sequence rco-MIR395d

AccessionMI0013416 (change log)
DescriptionRicinus communis miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

2 open access papers mention rco-MIR395d
(7 sentences)

Stem-loop
   -    -        ug c       u         uu    aag 
5'  cuag aguucccu  a cacuuca uguggauua  cuuc   c
    |||| ||||||||  | ||||||| |||||||||  ||||    
3'  gguc ucaagggg  u gugaagu acauuuggu  gagg   u
   u    c        gu u       c         -u    aac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973849.1: 136644-136730 [-]
intergenic
Clustered miRNAs
< 10kb from rco-MIR395d
rco-MIR395cEQ973849.1: 142167-142248 [+]
rco-MIR395dEQ973849.1: 136644-136730 [-]
rco-MIR395aEQ973849.1: 133932-134005 [-]
Database links

Mature sequence rco-miR395d

Accession MIMAT0014190
Sequence

62 - 

cugaaguguuugggggaacuc

 - 82

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).