Stem-loop sequence rco-MIR395e

AccessionMI0013417 (change log)
DescriptionRicinus communis miR395e stem-loop
Gene family MIPF0000016; MIR395
Literature search

2 open access papers mention rco-MIR395e
(7 sentences)

Stem-loop
   -- u          ug         cug   c   aa 
5'   c agaguucccu  aacacuuca   gga gaa  u
     | ||||||||||  |||||||||   ||| |||   
3'   g ucucaagggg  uugugaagu   ccu cuu  c
   ug u          gu         caa   u   ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973974.1: 61579-61652 [-]
intergenic
Database links

Mature sequence rco-miR395e

Accession MIMAT0014191
Sequence

49 - 

cugaaguguuugggggaacuc

 - 69

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).