Stem-loop sequence rco-MIR396

AccessionMI0013418 (change log)
DescriptionRicinus communis miR396 stem-loop
Gene family MIPF0000047; MIR396
Literature search

2 open access papers mention rco-MIR396
(5 sentences)

Stem-loop
   --  c                       c    ucuucuucuucuucuucuuagauuucuuu 
5'   ug uuuuccacagcuuucuugaacuu uucu                             c
     || ||||||||||||||||||||||| ||||                              
3'   ac agagggugucgaaagaacuugaa aaga                             u
   gu  a                       u    cacgguguaguucuuucuauauccguuac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973818.1: 920136-920259 [+]
intergenic
Database links

Mature sequence rco-miR396

Accession MIMAT0014192
Sequence

6 - 

uuccacagcuuucuugaacuu

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).