Stem-loop sequence rco-MIR398b

AccessionMI0013421 (change log)
DescriptionRicinus communis miR398b stem-loop
Gene family MIPF0000107; MIR398
Literature search

2 open access papers mention rco-MIR398b
(5 sentences)

Stem-loop
   --cua    a            u      --u       cuu  c    -uau    uuaucaucu 
5'      cagg gcgaccugagaa cacaug   ggacauu   ag uaua    accc         u
        |||| |||||||||||| ||||||   |||||||   || ||||    ||||          
3'      gucc cgcuggacucuu guguac   cuugugg   uc augu    uggg         c
   gggcc    c            -      uuu       -uu  -    uauu    uuuuauucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974235.1: 166476-166601 [-]
intergenic
Database links

Mature sequence rco-miR398b

Accession MIMAT0014195
Sequence

101 - 

uguguucucaggucgccccug

 - 121

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).