Stem-loop sequence rco-MIR399b

AccessionMI0013423 (change log)
DescriptionRicinus communis miR399b stem-loop
Gene family MIPF0000015; MIR399
Literature search

2 open access papers mention rco-MIR399b
(7 sentences)

Stem-loop
   --uuaca       a     a      u  a  -     -a  u    aaacca 
5'        gggcaaa ucucc uuggca gg ac cacua  ga aucc      a
          ||||||| ||||| |||||| || || |||||  || ||||      u
3'        cccguuu agagg aaccgu cc ug gugau  cu uagg      c
   auaacgg       -     a      c  g  u     aa  u    accgaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973891.1: 142031-142136 [-]
intergenic
Clustered miRNAs
< 10kb from rco-MIR399b
rco-MIR399bEQ973891.1: 142031-142136 [-]
rco-MIR399cEQ973891.1: 138457-138552 [-]
rco-MIR399fEQ973891.1: 134636-134722 [-]
Database links

Mature sequence rco-miR399b

Accession MIMAT0014197
Sequence

81 - 

ugccaaaggagauuugcccgg

 - 101

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).