Stem-loop sequence rco-MIR399d

AccessionMI0013425 (change log)
DescriptionRicinus communis miR399d stem-loop
Gene family MIPF0000015; MIR399
Literature search

2 open access papers mention rco-MIR399d
(7 sentences)

Stem-loop
   --          u     gc         ---aau   a    g   a    a 
5'   ucguagggca cucuc  uuggcaggc      gau ugaa uga gcua a
     |||||||||| |||||  |||||||||      ||| |||| ||| |||| u
3'   agugucccgu gagag  aaccguucg      cua guuu auu cgau u
   uc          c     ga         guaacc   -    g   a    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973773.1: 461879-461981 [+]
intergenic
Clustered miRNAs
< 10kb from rco-MIR399d
rco-MIR399dEQ973773.1: 461879-461981 [+]
rco-MIR399aEQ973773.1: 464925-465017 [+]
Database links

Mature sequence rco-miR399d

Accession MIMAT0014199
Sequence

78 - 

ugccaaaggagagcugcccug

 - 98

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).