Stem-loop sequence rco-MIR399e

AccessionMI0013426 (change log)
DescriptionRicinus communis miR399e stem-loop
Gene family MIPF0000015; MIR399
Literature search

2 open access papers mention rco-MIR399e
(7 sentences)

Stem-loop
   --uuaca      au      a        ua  -    -     -c    a  uaa 
5'        gggcaa  aucucc uuggcagg  gc cacu uuaga  augc uu   a
          ||||||  |||||| ||||||||  || |||| |||||  |||| ||    
3'        cccguu  uagagg aaccgucu  cg guga aauuu  uacg ag   u
   uuaacga      --      a        uc  u    c     au    -  uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973891.1: 152225-152332 [-]
intergenic
Database links

Mature sequence rco-miR399e

Accession MIMAT0014200
Sequence

83 - 

ugccaaaggagauuugcccag

 - 103

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).