Stem-loop sequence rco-MIR403a

AccessionMI0013428 (change log)
DescriptionRicinus communis miR403a stem-loop
Gene family MIPF0000290; MIR403
Literature search

1 open access papers mention rco-MIR403a
(1 sentences)

Stem-loop
   --  u u                    ucaggccauccaugucaggg 
5'   uc c aguuugugugugaaucuaau                    c
     || | ||||||||||||||||||||                    c
3'   ag g ucaaacacgcacuuagauug                    c
   cu  u c                    ugguacccuauccuaaucau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973968.1: 240845-240939 [-]
intergenic
Database links

Mature sequence rco-miR403a

Accession MIMAT0014202
Sequence

70 - 

uuagauucacgcacaaacucg

 - 90

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).