Stem-loop sequence rco-MIR403b

AccessionMI0013429 (change log)
DescriptionRicinus communis miR403b stem-loop
Gene family MIPF0000290; MIR403
Literature search

1 open access papers mention rco-MIR403b
(1 sentences)

Stem-loop
   --  u u                g   c    ---ca  --aa    guuc 
5'   uc c aguuugugcgugaauc agc ccau     uc    ggcc    a
     || | |||||||||||||||| ||| ||||     ||    ||||    u
3'   ag g ucaaacacgcacuuag uug ggua     ag    ccgg    u
   cu  u c                a   u    accua  cacc    aguu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973835.1: 375406-375503 [-]
intergenic
Database links

Mature sequence rco-miR403b

Accession MIMAT0014203
Sequence

73 - 

uuagauucacgcacaaacucg

 - 93

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).