Stem-loop sequence rco-MIR408

AccessionMI0013430 (change log)
DescriptionRicinus communis miR408 stem-loop
Gene family MIPF0000102; MIR408
Literature search

2 open access papers mention rco-MIR408
(3 sentences)

Stem-loop
   --a   acu     c          u  a        cu      a 
5'    aag   gggaa aggcagugca gg uggggcua  aacaga a
      |||   ||||| |||||||||| || ||||||||  |||||| a
3'    uuc   cccuu uccgucacgu cc aucucggu  uugucu c
   gcc   ggu     c          c  c        -u      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973790.1: 821262-821353 [+]
intergenic
Database links

Mature sequence rco-miR408

Accession MIMAT0014204
Sequence

67 - 

cugcacugccucuucccuggc

 - 87

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).