Stem-loop sequence rco-MIR535

AccessionMI0013431 (change log)
DescriptionRicinus communis miR535 stem-loop
Gene family MIPF0000136; MIR535
Literature search

1 open access papers mention rco-MIR535
(1 sentences)

Stem-loop
   --  ug          g  a         u  ua  cu      a 
5'   uu  uugacaacga ag gagcacgcu gu  gc  ucaugu a
     ||  |||||||||| || ||||||||| ||  ||  |||||| g
3'   ga  aacuguugcu uc cucgugcga ca  cg  gguaca g
   ua  gu          a  c         c  ca  uu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ974037.1: 215567-215657 [-]
intergenic
Database links

Mature sequence rco-miR535

Accession MIMAT0014205
Sequence

6 - 

ugacaacgagagagagcacgc

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).