Stem-loop sequence rco-MIR160c

AccessionMI0013432 (change log)
DescriptionRicinus communis miR160c stem-loop
Gene family MIPF0000032; MIR160
Literature search

2 open access papers mention rco-MIR160c
(4 sentences)

Stem-loop
   -- ua     c         ga      uc  a    c       ac 
5'   g  ucugc uggcucccu  augcca  ua gaag uugucaa  a
     |  ||||| |||||||||  ||||||  || |||| |||||||   
3'   c  ggacg acugagggg  uacggu  au cuuu aacgguu  g
   ug cc     u         ag      uu  c    u       gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_RCG_1.1; JCVI_RCG_1.1) Overlapping transcripts
EQ973951.1: 175486-175579 [+]
intergenic
Database links

Mature sequence rco-miR160c

Accession MIMAT0014206
Sequence

6 - 

ugccuggcucccugaaugcca

 - 26

Get sequence
Evidence experimental; RT-PCR [1]

References

1
PMID:19942686 "Conservation and divergence of microRNAs and their functions in Euphorbiaceous plants" Zeng C, Wang W, Zheng Y, Chen X, Bo W, Song S, Zhang W, Peng M Nucleic Acids Res. 38:981-995(2010).