![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence aae-mir-184 |
|||||
Accession | MI0013433 (change log) | ||||
Description | Aedes aegypti miR-184 stem-loop | ||||
Gene family | MIPF0000059; mir-184 | ||||
Literature search |
![]()
4 open access papers mention aae-mir-184 | ||||
Stem-loop |
cc u ua - g c c - ua 5' ggug auucg cccuuauca uucuu cg cc gu guua u |||| ||||| ||||||||| ||||| || || || |||| 3' ccac ugggc gggaauagu aagag gc gg ca cggu u uu - cc c - a u g ug |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Comments |
This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2]. |
||||
Genome context |
|
||||
Database links |
|
Mature sequence aae-miR-184 |
|
Accession | MIMAT0014207 |
Sequence |
55 - uggacggagaacugauaagggc - 76 |
Deep sequencing | 1702890 reads, 2 experiments |
Evidence | experimental; 454 [1], Illumina [2] |
References |
|
1 | |
2 |
PMID:20167119
"Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus"
BMC Genomics. 11:119(2010).
|