Stem-loop sequence aae-mir-970

AccessionMI0013498 (change log)
DescriptionAedes aegypti miR-970 stem-loop
Gene family MIPF0000700; mir-970
Literature search

1 open access papers mention aae-mir-970
(1 sentences)

Stem-loop 
   aac   -a   cg       u        u    u       gc       gaau 
5'    ggu  uug  gcuuuca agguagcu gcgu ugucuua  ugguauu    g
      |||  |||  ||||||| |||||||| |||| |||||||  |||||||     
3'    cua  aac  ugagagu uuuaucgg cgca acagaau  acuaugg    u
   guu   cg   ua       u        -    c       --       auag
Get sequence
Deep sequencing
159410 reads, 7.85e+03 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This miRNA was identified independently in Aedes aegypti [1] and in the closely related Aedes albopictus, for which there was no genome sequence [2]. The latter reads were therefore also mapped to the Aedes aegypti genome [2].

Genome context
Coordinates (AaegL1) Overlapping transcripts
supercont1.229: 1045811-1045918 [+]
intergenic
Database links

Mature sequence aae-miR-970

Accession MIMAT0014292
Sequence

65 -  

ucauaagacacacgcggcuau

 - 85

Get sequence
Deep sequencing159152 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:19961592 "Direct sequencing and expression analysis of a large number of miRNAs in Aedes aegypti and a multi-species survey of novel mosquito miRNAs" Li S, Mead EA, Liang S, Tu Z BMC Genomics. 10:581(2009).
2
PMID:20167119 "Identification of microRNAs expressed in two mosquito vectors, Aedes albopictus and Culex quinquefasciatus" Skalsky RL, Vanlandingham DL, Scholle F, Higgs S, Cullen BR BMC Genomics. 11:119(2010).