Stem-loop sequence tgu-mir-2956-1

AccessionMI0013640 (change log)
DescriptionTaeniopygia guttata miR-2956-1 stem-loop
Gene family MIPF0000933; mir-2956
Literature search

1 open access papers mention tgu-mir-2956-1
(1 sentences)

Stem-loop
               a                       cug 
5' aagugggaauaa uaggaaaccaggcuuuauuaguu   a
   |||||||||||| |||||||||||||||||||||||   u
3' uucauccuuauu auccuuugguccgaaauaaucaa   u
               c                       aua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4A: 17209002-17209082 [-]
antisense
Clustered miRNAs
< 10kb from tgu-mir-2956-1
tgu-mir-2956-2chr4A: 17209002-17209082 [+]
tgu-mir-2956-1chr4A: 17209002-17209082 [-]
Database links

Mature sequence tgu-miR-2956

Accession MIMAT0014454
Sequence

14 - 

uaggaaaccaggcuuuauuagu

 - 35

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).