Stem-loop sequence tgu-mir-2983

AccessionMI0013681 (change log)
DescriptionTaeniopygia guttata miR-2983 stem-loop
Literature search

1 open access papers mention tgu-mir-2983
(2 sentences)

Stem-loop 
                                ca  a g 
5' ccggacuggcuccaucaagccuguuggaa  gc g a
   |||||||||||||||||||||||||||||  || |  
3' ggucugaccgagguaguucggacgaccuu  cg c a
                                uc  g c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr5: 14115790-14115863 [+]
sense
ENSTGUT00000009851 ; DUSP8-201; intron 2
antisense
ENSTGUT00000009807 ; SYT8-201; intron 1
Database links

Mature sequence tgu-miR-2983

Accession MIMAT0014493
Sequence

45 -  

uuuccagcaggcuugauggag

 - 65

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).