Stem-loop sequence tgu-mir-218-1

AccessionMI0013729 (change log)
DescriptionTaeniopygia guttata miR-218-1 stem-loop
Gene family MIPF0000026; mir-218
Literature search

1 open access papers mention tgu-mir-218-1
(1 sentences)

Stem-loop 
   -----------------------------a   u      u         cu        gguugugag 
5'                               gau uucugu gugcuugau  aaccaugu         g
                                 ||| |||||| |||||||||  ||||||||          
3'                               cug aaggua cacgaacug  uugguaca         u
   ucgucgaacgguacgacaucuuucgacgca   c      c         uc        aaaugagua
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr4: 54394615-54394725 [-]
sense
ENSTGUT00000010024 ; SLIT2-201; intron 14
Database links

Mature sequence tgu-miR-218-5p

Accession MIMAT0014522
Sequence

11 -  

uugugcuugaucuaaccaugu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

Mature sequence tgu-miR-218-3p

Accession MIMAT0026984
Sequence

50 -  

aaacaugguucugucaagcac

 - 70

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).