Stem-loop sequence tgu-mir-137

AccessionMI0013757 (change log)
DescriptionTaeniopygia guttata miR-137 stem-loop
Gene family MIPF0000106; mir-137
Literature search

1 open access papers mention tgu-mir-137
(1 sentences)

Stem-loop 
   --------  ug   g           ug a     -  g 
5'         gg  acg guauucuuggg  g uaaua cg a
           ||  ||| |||||||||||  | ||||| || u
3'         cu  ugc cauaagaauuc  u auugu gc u
   gagaggag  ga   g           gu -     u  a
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr8: 8780107-8780179 [+]
sense
ENSTGUT00000018635 ; tgu-mir-137-201; exon 1
Database links

Mature sequence tgu-miR-137-5p

Accession MIMAT0026995
Sequence

5 -  

acggguauucuuggguggauaau

 - 27

Get sequence
Evidence experimental; Illumina [2]

Mature sequence tgu-miR-137-3p

Accession MIMAT0014543
Sequence

41 -  

uuauugcuuaagaauacgcguag

 - 63

Get sequence
Evidence experimental; 454 [1], Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).