Stem-loop sequence tgu-mir-2992

AccessionMI0013765 (change log)
DescriptionTaeniopygia guttata miR-2992 stem-loop
Literature search

1 open access papers mention tgu-mir-2992
(1 sentences)

Stem-loop 
   ggcggcagggcc                -u     u g g 
5'             ccggcaggacaaaguc  cucug g a g
               ||||||||||||||||  ||||| | |  
3'             ggccguccuguuucgg  gagac c u g
   ----------cg                cc     u g c
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chrZ: 57612703-57612773 [+]
intergenic
Database links

Mature sequence tgu-miR-2992

Accession MIMAT0014549
Sequence

11 -  

ccccggcaggacaaagucucu

 - 31

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).