Stem-loop sequence tgu-mir-204-2

AccessionMI0013792 (change log)
DescriptionTaeniopygia guttata miR-204-2 stem-loop
Gene family MIPF0000042; mir-204
Literature search

1 open access papers mention tgu-mir-204-2
(1 sentences)

Stem-loop 
   accug     u         ca    a     g aga 
5'      ugggc ucccuuugu  uccu ugccu g   u
        ||||| |||||||||  |||| ||||| |   c
3'      acucg agggaaacg  aggg acgga u   a
   ----g     u         ac    -     g gac
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (taeGlu3.2.4) Overlapping transcripts
chr10: 5338529-5338600 [+]
sense
ENSTGUT00000018633 ; tgu-mir-204-2-201; exon 1
ENSTGUT00000005764 ; TRPM1-201; intron 5
Database links

Mature sequence tgu-miR-204

Accession MIMAT0014570
Sequence

11 -  

uucccuuugucauccuaugccu

 - 32

Get sequence
Evidence experimental; Illumina [1-2]

References

1
PMID:20360741 "The genome of a songbird" Warren WC, Clayton DF, Ellegren H, Arnold AP, Hillier LW, Kunstner A, Searle S, White S, Vilella AJ, Fairley S, Heger A, Kong L, Ponting CP, Jarvis ED, Mello CV, Minx P, Lovell P, Velho TA, Ferris M, Balakrishnan CN, Sinha S, Blatti C, London SE, Li Y, Li Nature. 464:757-762(2010).
2
PMID:23268654 "Genome-wide annotation and analysis of zebra finch microRNA repertoire reveal sex-biased expression" Luo GZ, Hafner M, Shi Z, Brown M, Feng GH, Tuschl T, Wang XJ, Li X BMC Genomics. 13:727(2012).