Stem-loop sequence api-mir-1000

AccessionMI0013910 (change log)
DescriptionAcyrthosiphon pisum miR-1000 stem-loop
Gene family MIPF0000701; mir-1000
Stem-loop
   --auau        c         -aug   cg 
5'       uguccugu acagcagua    uca  u
         |||||||| |||||||||    |||   
3'       acagggcg ugucgucau    agu  a
   gcuuuu        c         gcua   cu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349899.1: 512678-512742 [+]
intergenic
Database links

Mature sequence api-miR-1000

Accession MIMAT0014711
Sequence

1 - 

auauuguccugucacagcagua

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).