Stem-loop sequence api-mir-263a

AccessionMI0013918 (change log)
DescriptionAcyrthosiphon pisum miR-263a stem-loop
Gene family MIPF0000122; mir-263
Literature search

1 open access papers mention api-mir-263a
(1 sentences)

Stem-loop
   --a       u   a     c     guacauau 
5'    auggcac gaa gaauu acggg        u
      ||||||| ||| ||||| |||||         
3'    ugccgug cuu cuuga ugccc        u
   uua       u   -     -     acuacaca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349685.1: 873342-873407 [-]
intergenic
Database links

Mature sequence api-miR-263a

Accession MIMAT0014718
Sequence

1 - 

aauggcacugaaagaauucacggg

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).