Stem-loop sequence api-mir-263b

AccessionMI0013920 (change log)
DescriptionAcyrthosiphon pisum miR-263b stem-loop
Gene family MIPF0000122; mir-263
Literature search

1 open access papers mention api-mir-263b
(1 sentences)

Stem-loop
   --c       ug a   a     a  -  aau 
5'    uuggcac  g aga uucac ga cu   u
      |||||||  | ||| ||||| || ||   a
3'    aacugug  c ucu gagug cu ga   u
   auc       gu c   -     -  a  agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349685.1: 845892-845953 [-]
intergenic
Database links

Mature sequence api-miR-263b

Accession MIMAT0014720
Sequence

1 - 

cuuggcacuggaagaauucacaga

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).