Stem-loop sequence api-mir-278

AccessionMI0013923 (change log)
DescriptionAcyrthosiphon pisum miR-278 stem-loop
Gene family MIPF0000155; mir-278
Stem-loop
   --            uu    a    ugu   aga 
5'   acggacgaaggu  cauc aucg   uac   u
     ||||||||||||  |||| ||||   |||    
3'   ugcuugcuuuca  gugg uggc   gug   a
   uu            gg    c    --u   caa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349849.1: 357516-357581 [-]
intergenic
Database links

Mature sequence api-miR-278

Accession MIMAT0014723
Sequence

45 - 

ucggugggacuuucguucguuu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).