Stem-loop sequence api-mir-279a

AccessionMI0013924 (change log)
DescriptionAcyrthosiphon pisum miR-279a stem-loop
Gene family MIPF0000184; mir-279
Stem-loop
   --         ug      ga    - -   uua 
5'   augggugug  ucuagu  caug c guu   u
     |||||||||  ||||||  |||| | |||    
3'   uacucacac  agauca  guac g cag   a
   cc         cu      --    a a   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Acyr_2.0; GCA_000142985.2) Overlapping transcripts
GL349806.1: 546384-546447 [-]
intergenic
Database links

Mature sequence api-miR-279a

Accession MIMAT0014724
Sequence

44 - 

ugacuagauccacacucaucc

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:20444247 "Bioinformatic prediction, deep sequencing of microRNAs and expression analysis during phenotypic plasticity in the pea aphid, Acyrthosiphon pisum" Legeai F, Rizk G, Walsh T, Edwards O, Gordon K, Lavenier D, Leterme N, Mereau A, Nicolas J, Tagu D, Jaubert-Possamai S BMC Genomics. 11:281(2010).